Stem-loop sequence rgl-MIR7810

AccessionMI0025464 (change log)
DescriptionRehmannia glutinosa miR7810 stem-loop
Stem-loop
   -    -    ---              --uu   g    uug    ga 
5'  gagu auug   agagaggaagaguu    cug cucg   cucg  u
    |||| ||||   ||||||||||||||    ||| ||||   ||||   
3'  uuca uaac   uuuuuuuuuuucgg    gau gagu   gagc  c
   c    a    cuu              uuac   g    uaa    ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rgl-miR7810

Accession MIMAT0032256
Sequence

11 - 

agaggaagaguuuucuggcuc

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23861915 "Transcriptome/degradome-wide identification of R. glutinosa miRNAs and their targets: the role of miRNA activity in the replanting disease" Li MJ, Yang YH, Chen XJ, Wang FQ, Lin WX, Yi YJ, Zeng L, Yang SY, Zhang ZY PLoS One. 8:e68531(2013).