Stem-loop sequence rgl-MIR7811

AccessionMI0025465 (change log)
DescriptionRehmannia glutinosa miR7811 stem-loop
Literature search

1 open access papers mention rgl-MIR7811
(1 sentences)

Stem-loop
   cau   uca     ugg g       --       u   cauu 
5'    acu   uugaa   a auacgga  augaagc uau    g
      |||   |||||   | |||||||  ||||||| |||    c
3'    uga   ggcuu   u uaugccu  uacuucg aua    c
   auc   -ug     uaa g       aa       u   aagc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rgl-miR7811

Accession MIMAT0032257
Sequence

11 - 

ugaauggagauacggaaugaagc

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23861915 "Transcriptome/degradome-wide identification of R. glutinosa miRNAs and their targets: the role of miRNA activity in the replanting disease" Li MJ, Yang YH, Chen XJ, Wang FQ, Lin WX, Yi YJ, Zeng L, Yang SY, Zhang ZY PLoS One. 8:e68531(2013).