Stem-loop sequence rgl-MIR7807b

AccessionMI0025466 (change log)
DescriptionRehmannia glutinosa miR7807b stem-loop
Gene family MIPF0002091; MIR7807
Stem-loop
   a        c                            uuc         -  ggaa    g  acua   a  c 
5'  aaaauagu caguaacuauaugaaaaucucaauuuug   cuaauuuca cc    auuu ga    cac ug c
    |||||||| ||||||||||||||||||||||||||||   ||||||||| ||    |||| ||    ||| ||  
3'  uuuuauca gucauugauauacuuuuagaguuaaaac   gauuaaagu gg    uaaa uu    gug ac a
   -        u                            cau         a  ---a    g  ---a   c  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rgl-miR7807b-5p

Accession MIMAT0032258
Sequence

14 - 

uaacuauaugaaaaucucaauu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence rgl-miR7807b-3p

Accession MIMAT0032259
Sequence

113 - 

uugagauuuucauauaguuacu

 - 134

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23861915 "Transcriptome/degradome-wide identification of R. glutinosa miRNAs and their targets: the role of miRNA activity in the replanting disease" Li MJ, Yang YH, Chen XJ, Wang FQ, Lin WX, Yi YJ, Zeng L, Yang SY, Zhang ZY PLoS One. 8:e68531(2013).