Stem-loop sequence rgl-MIR7797b

AccessionMI0025467 (change log)
DescriptionRehmannia glutinosa miR7797b stem-loop
Stem-loop
   -       --  a        cg     c    uucucuuaauaagcaaaaacauuucaagaa 
5'  aaacuug  ag uuugauuu  ucuua auuu                              a
    |||||||  || ||||||||  ||||| ||||                              c
3'  uuuggau  uc aagcuaag  ggaau uaaa                              c
   u       ag  c        au     a    uccuccaauugacaaauuuuugucgucccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rgl-miR7797b

Accession MIMAT0032260
Sequence

11 - 

uuugauuucgucuuacauuuuuc

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23861915 "Transcriptome/degradome-wide identification of R. glutinosa miRNAs and their targets: the role of miRNA activity in the replanting disease" Li MJ, Yang YH, Chen XJ, Wang FQ, Lin WX, Yi YJ, Zeng L, Yang SY, Zhang ZY PLoS One. 8:e68531(2013).