Stem-loop sequence hsa-mir-7855

AccessionMI0025525 (change log)
Symbol HGNC:MIR7855
DescriptionHomo sapiens miR-7855 stem-loop
Literature search

1 open access papers mention hsa-mir-7855
(11 sentences)

Stem-loop 
         u     cc   --   u   -   u 
5' gcuugg gagga  cca  agc cgg cac a
   |||||| |||||  |||  ||| ||| |||  
3' cggacc uuccu  ggu  ucg guc gug u
         u     uc   uu   u   a   u
Get sequence
Deep sequencing
32 reads, 35.7 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 64785626-64785686 [-]
sense
OTTHUMT00000412156 ; ESR2-002; intron 1
OTTHUMT00000412155 ; ESR2-003; intron 2
ENST00000358599 ; ESR2-002; intron 1
ENST00000554572 ; ESR2-003; intron 2
Database links

Mature sequence hsa-miR-7855-5p

Accession MIMAT0030430
Sequence

3 -  

uuggugaggaccccaagcucgg

 - 24

Get sequence
Deep sequencing23 reads, 8 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).