Stem-loop sequence bta-mir-2284ac

AccessionMI0025542 (change log)
DescriptionBos taurus miR-2284ac stem-loop
Gene family MIPF0000747; mir-2284
Literature search

13 open access papers mention bta-mir-2284ac
(32 sentences)

Stem-loop 
   -aaau       ug c      ca  cu 
5'      guucgcu  g uuuuuc  ua  a
        |||||||  | ||||||  ||   
3'      caaguga  c aaaaag  au  c
   cuuuu       gu c      ac  uc
Get sequence
Deep sequencing
489 reads, 0 reads per million, 63 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr27: 18642867-18642923 [+]
intergenic
Database links

Mature sequence bta-miR-2284ac

Accession MIMAT0030447
Sequence

1 -  

aaauguucgcuuggcuuuuucc

 - 22

Get sequence
Deep sequencing72 reads, 40 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23472090 "Next generation sequencing reveals the expression of a unique miRNA profile in response to a gram-positive bacterial infection" Lawless N, Foroushani AB, McCabe MS, O'Farrelly C, Lynn DJ PLoS One. 8:e57543(2013).