Stem-loop sequence rgl-MIR7972

AccessionMI0025746 (change log)
DescriptionRehmannia glutinosa miR7972 stem-loop
Stem-loop
   cuga         a   uu               cgucuuccauggcguccgucccaaaccagucuuccuauauguggaaaggguacacaaaggaagaa 
5'     aucgaagga aau  caagcuugacaaaua                                                                 a
       ||||||||| |||  |||||||||||||||                                                                  
3'     uagcuuccu uua  guucggacuguuuau                                                                 g
   gcgg         c   uu               ucugacugagggaauuuuuaccaccuuucucauaacaccugauaaaacgaucagaaaacacauag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rgl-miR7972

Accession MIMAT0032261
Sequence

170 - 

uugucaggcuuguuauucucc

 - 190

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23861915 "Transcriptome/degradome-wide identification of R. glutinosa miRNAs and their targets: the role of miRNA activity in the replanting disease" Li MJ, Yang YH, Chen XJ, Wang FQ, Lin WX, Yi YJ, Zeng L, Yang SY, Zhang ZY PLoS One. 8:e68531(2013).