Stem-loop sequence mmu-mir-3473f

AccessionMI0026016 (change log)
Symbol MGI:Mir3473f
DescriptionMus musculus miR-3473f stem-loop
Gene family MIPF0001230; mir-3473
Literature search

4 open access papers mention mmu-mir-3473f
(72 sentences)

Stem-loop 
   -----    cu       -  ua   - cc    a                 -  cc      -     caa 
5'      ucug  agagcag ca  ugc c  aacc cugagccaucucuccag cc  uuuguu guuuu   u
        ||||  ||||||| ||  ||| |  |||| ||||||||||||||||| ||  |||||| |||||    
3'      agac  ucucguc gu  acg g  uugg gacucgguagagagguc gg  aaacga uaaaa   a
   ucugg    cu       a  -c   a aa    c                 a  au      a     uac
Get sequence
Deep sequencing
43591 reads, 6.87e+03 reads per million, 163 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 106546496-106546631 [-]
sense
OTTMUST00000052517 ; Bcl2-001; intron 1
ENSMUST00000112751 ; Bcl2-001; intron 1
antisense
OTTMUST00000052532 ; AC162916.2-001; intron 2
OTTMUST00000052533 ; AC162916.2-002; intron 2
ENSMUST00000149909 ; D630008O14Rik-001; intron 2
ENSMUST00000144260 ; D630008O14Rik-002; intron 2
Database links

Mature sequence mmu-miR-3473f

Accession MIMAT0031390
Sequence

77 -  

caaauaggacuggagagaug

 - 96

Get sequence
Deep sequencing34587 reads, 96 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23185045 "Profiling of T helper cell-derived small RNAs reveals unique antisense transcripts and differential association of miRNAs with argonaute proteins 1 and 2" Polikepahad S, Corry DB Nucleic Acids Res. 41:1164-1177(2013).