Stem-loop sequence mmu-mir-142b

AccessionMI0026028 (change log)
Symbol MGI:Mir142b
DescriptionMus musculus miR-142b stem-loop
Gene family MIPF0000084; mir-142
Literature search

166 open access papers mention mmu-mir-142b
(1909 sentences)

Stem-loop
   gc    u ucc  agccc        c                  a      acccucc 
5'   gugg c   ga     acagugca ucauccauaaaguaggaa cacuac       a
     |||| |   ||     |||||||| |||||||||||||||||| ||||||       g
3'   cacc g   cu     ugucacgu aguggguauuucaucuuu gugaug       u
   --    u --u  --guc        c                  c      auugucg 
Get sequence
Deep sequencing
789 reads, 6.17 reads per million, 81 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 87756841-87756955 [-]
antisense
OTTMUST00000002656 ; RP23-449P23.3-001; intron 1
ENSMUST00000123700 ; A430104N18Rik-001; intron 1
Clustered miRNAs
< 10kb from mmu-mir-142b
mmu-mir-142achr11: 87756864-87756927 [+]
mmu-mir-142bchr11: 87756841-87756955 [-]
Database links

Mature sequence mmu-miR-142b

Accession MIMAT0031402
Sequence

31 - 

uccauaaaguaggaaacacu

 - 50

Get sequence
Deep sequencing309 reads, 61 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1