Stem-loop sequence ppe-MIR403

AccessionMI0026135 (change log)
DescriptionPrunus persica miR403 stem-loop
Gene family MIPF0000290; MIR403
Literature search

2 open access papers mention ppe-MIR403
(2 sentences)

Stem-loop
         c     c                g   c    -----------c   gc   cc   u 
5' gggaca auccc aguuugugcgugaauc aac ccau            aca  cgu  auc u
   |||||| ||||| |||||||||||||||| ||| ||||            |||  |||  ||| u
3' cucugu uaggg ucaaacacgcacuuag uug ggua            ugu  gca  uag a
         a     c                a   u    accuaacucaau   -a   -c   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG1: 9127091-9127208 [+]
intergenic
Database links

Mature sequence ppe-miR403

Accession MIMAT0031511
Sequence

87 - 

uuagauucacgcacaaacucg

 - 107

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).