Stem-loop sequence bbe-let-7a-1

AccessionMI0026170 (change log)
DescriptionBranchiostoma belcheri let-7a-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention bbe-let-7a-1
(3 sentences)

Stem-loop
   -----      u       ua            gagaaguac 
5'      cugagg gagguag  gguuguauaguu         a
        |||||| |||||||  ||||||||||||         a
3'      ggcuuu uuccauu  ccaacaugucag         c
   uacug      u       gc            uagagguua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bbe-let-7a-5p

Accession MIMAT0031568
Sequence

7 - 

ugagguaguagguuguauaguu

 - 28

Get sequence
Evidence not experimental

Mature sequence bbe-let-7a-3p

Accession MIMAT0031569
Sequence

50 - 

gacuguacaacccguuaccuu

 - 70

Get sequence
Evidence not experimental

References

1
PMID:23335747 "Genome-wide analyses of amphioxus microRNAs reveal an immune regulation via miR-92d targeting C3" Yang R, Zheng T, Cai X, Yu Y, Yu C, Guo L, Huang S, Zhu W, Zhu R, Yan Q, Ren Z, Chen S, Xu A J Immunol. 190:1491-1500(2013).