Stem-loop sequence bbe-let-7a-2

AccessionMI0026171 (change log)
DescriptionBranchiostoma belcheri let-7a-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention bbe-let-7a-2
(3 sentences)

Stem-loop
   agacaa g    g  ug   u   g                  agaagua  u 
5'       g gugc cc  agg gag uaguagguuguauaguug       ca c
         | |||| ||  ||| ||| ||||||||||||||||||       ||  
3'       c uacg gg  ucc cuc aucguccaacgugucaau       gu a
   -----c g    -  gu   u   g                  ---agag  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bbe-let-7a-5p

Accession MIMAT0031568
Sequence

21 - 

ugagguaguagguuguauaguu

 - 42

Get sequence
Evidence not experimental

Mature sequence bbe-let-7a-2-3p

Accession MIMAT0031862
Sequence

66 - 

cugugcaaccugcuagcucucc

 - 87

Get sequence
Evidence not experimental

References

1
PMID:23335747 "Genome-wide analyses of amphioxus microRNAs reveal an immune regulation via miR-92d targeting C3" Yang R, Zheng T, Cai X, Yu Y, Yu C, Guo L, Huang S, Zhu W, Zhu R, Yan Q, Ren Z, Chen S, Xu A J Immunol. 190:1491-1500(2013).