Stem-loop sequence ssa-let-7j

AccessionMI0026422 (change log)
DescriptionSalmo salar let-7j stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ssa-let-7j
(5 sentences)

Stem-loop
   --u   gu         g      uuagg   aca   a 
5'    gag  aguagguug auaguu     guc   ccc c
      |||  ||||||||| ||||||     |||   ||| a
3'    uuc  ucauccaac ugucaa     uag   ggg c
   ucu   ug         a      -----   --a   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-let-7j-5p

Accession MIMAT0032263
Sequence

1 - 

ugagguaguagguuggauaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-let-7j-3p

Accession MIMAT0032264
Sequence

51 - 

cuguacaaccuacugucuuucu

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1