Stem-loop sequence ssa-let-7c-1

AccessionMI0026423 (change log)
DescriptionSalmo salar let-7c-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ssa-let-7c-1
(5 sentences)

Stem-loop
   --u   g   u            uuagaa    a    
5'    gag uag agguuguauggu      ugac ccc 
      ||| ||| ||||||||||||      |||| || u
3'    uuc auc uccaacauguca      auug gga 
   ccu   g   u            ------    a    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-let-7c-5p

Accession MIMAT0032265
Sequence

1 - 

ugagguaguagguuguaugguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-let-7c-3p

Accession MIMAT0032266
Sequence

46 - 

cuguacaaccuucuagcuuucc

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1