Stem-loop sequence ssa-let-7c-2

AccessionMI0026424 (change log)
DescriptionSalmo salar let-7c-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ssa-let-7c-2
(5 sentences)

Stem-loop
   ---u   g   u         g  uuagaa    a    
5'     gag uag agguuguau gu      ugac ccc 
       ||| ||| ||||||||| ||      |||| || u
3'     uuc auc uccaacaug ca      auug ggg 
   uccu   g   u         g  ------    a    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-let-7c-5p

Accession MIMAT0032265
Sequence

1 - 

ugagguaguagguuguaugguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-let-7c-2-3p

Accession MIMAT0032267
Sequence

46 - 

cgguacaaccuucuagcuuuccu

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1