Stem-loop sequence ssa-let-7h

AccessionMI0026428 (change log)
DescriptionSalmo salar let-7h stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ssa-let-7h
(5 sentences)

Stem-loop
   --u                 u      --------    au  gg 
5'    gagguaguaaguugugu guuguu        gggg  ca  a
      ||||||||||||||||| ||||||        ||||  ||   
3'    uuccgucauucaacaua caauag        cccc  gu  u
   ucc                 u      agggcaug    gc  ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-let-7h-5p

Accession MIMAT0032272
Sequence

1 - 

ugagguaguaaguuguguuguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-let-7h-3p

Accession MIMAT0032273
Sequence

61 - 

cuauacaacuuacugccuuccu

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1