Stem-loop sequence ssa-let-7i-2

AccessionMI0026430 (change log)
DescriptionSalmo salar let-7i-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ssa-let-7i-2
(5 sentences)

Stem-loop
   --u                 u  ugguuggguuauga       cg 
5'    gagguaguaguuugugc gu              cauuucc  c
      ||||||||||||||||| ||              |||||||   
3'    uuccgucaucgaacgcg ca              guagagg  u
   ccg                 u  --------------       ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-let-7i-5p

Accession MIMAT0032274
Sequence

1 - 

ugagguaguaguuugugcuguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-let-7i-2-3p

Accession MIMAT0032276
Sequence

57 - 

cugcgcaagcuacugccuugcc

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1