Stem-loop sequence ssa-mir-128-1

AccessionMI0026461
DescriptionSalmo salar miR-128-1 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   --c        ga      cu       c 
5'    ggggccgg  cgcugu  gagaguu u
      ||||||||  ||||||  |||||||  
3'    cucuggcc  gugaca  cucuuag a
   uuu        aa      --       u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence ssa-miR-128-1-5p

Accession MIMAT0032313
Sequence

1 - 

cggggccgggacgcugucugaga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-128-3p

Accession MIMAT0032314
Sequence

36 - 

ucacagugaaccggucucuuu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1