Stem-loop sequence ssa-mir-128-3

AccessionMI0026463 (change log)
DescriptionSalmo salar miR-128-3 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   --c        gg      cu     gcc 
5'    ggggccgg  cgcugu  gagag   u
      ||||||||  ||||||  |||||    
3'    cucuggcc  gugaca  cucuu   a
   uuu        aa      --     aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-128-3-5p

Accession MIMAT0032316
Sequence

1 - 

cggggccggggcgcugucugaga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-128-3p

Accession MIMAT0032314
Sequence

36 - 

ucacagugaaccggucucuuu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1