Stem-loop sequence ssa-mir-128-4

AccessionMI0026464 (change log)
DescriptionSalmo salar miR-128-4 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   --        uua      aa     g ag 
5'   gggggccg   cacugu  gagau u  u
     ||||||||   ||||||  ||||| |   
3'   ucucuggc   gugaca  cucug a  c
   uu        caa      --     g gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-128-4-5p

Accession MIMAT0032317
Sequence

1 - 

gggggccguuacacuguaaga

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-128-3p

Accession MIMAT0032314
Sequence

38 - 

ucacagugaaccggucucuuu

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1