Stem-loop sequence ssa-let-7a-3

AccessionMI0026741 (change log)
DescriptionSalmo salar let-7a-3 stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ssa-let-7a-3
(6 sentences)

Stem-loop
   --u   gu                ---------uu    u 
5'    gag  aguagguuguauaguu           aggg c
      |||  ||||||||||||||||           |||| a
3'    uuc  ucauucaacauaucaa           uccc u
   ccu   ug                uagacuguccu    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-let-7a-5p

Accession MIMAT0032688
Sequence

1 - 

ugagguaguagguuguauaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-let-7a-3-3p

Accession MIMAT0032690
Sequence

51 - 

cuauacaacuuacugucuuucc

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1