Stem-loop sequence ssa-let-7a-2

AccessionMI0026742 (change log)
DescriptionSalmo salar let-7a-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ssa-let-7a-2
(6 sentences)

Stem-loop
   --u   g   u              agaa ua a 
5'    gag uag agguuguauaguug    u  c c
      ||| ||| ||||||||||||||    |  | c
3'    uuc auc uccgacaugucaau    a  g c
   ccu   g   c              --ag gg c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-let-7a-5p

Accession MIMAT0032688
Sequence

1 - 

ugagguaguagguuguauaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-let-7a-3p

Accession MIMAT0032689
Sequence

46 - 

cuguacagccuccuagcuuucc

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1