Stem-loop sequence ssa-let-7a-4

AccessionMI0026743 (change log)
DescriptionSalmo salar let-7a-4 stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ssa-let-7a-4
(6 sentences)

Stem-loop
   --u          gu         ---- g    a       
5'    gagguaguag  uguauaguu    u uggg gggauu 
      ||||||||||  |||||||||    | |||| ||||| u
3'    uuccguuauc  acauaucaa    g acuu uccuaa 
   ucc          ug         uagu g    a       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-let-7a-5p

Accession MIMAT0032688
Sequence

1 - 

ugagguaguagguuguauaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-let-7a-4-3p

Accession MIMAT0032691
Sequence

56 - 

cuauacagucuauugccuuccu

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1