Stem-loop sequence ssa-let-7a-5

AccessionMI0026744 (change log)
DescriptionSalmo salar let-7a-5 stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ssa-let-7a-5
(6 sentences)

Stem-loop
   --u          gu         ugugaag      a 
5'    gagguaguag  uguauaguu       ggauag a
      ||||||||||  |||||||||       ||||||  
3'    uuccguuauc  acauaucaa       cuuauc u
   ucc          ug         uagugga      c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-let-7a-5p

Accession MIMAT0032688
Sequence

1 - 

ugagguaguagguuguauaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-let-7a-5-3p

Accession MIMAT0032692
Sequence

55 - 

cuauacagucuauugccuuccu

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1