Stem-loop sequence ssa-let-7b-2

AccessionMI0026753 (change log)
DescriptionSalmo salar let-7b-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ssa-let-7b-2
(7 sentences)

Stem-loop
   --u                ug   uca  g  g    uuu 
5'    gagguaguagguugug  guu   gg uu ugau   g
      ||||||||||||||||  |||   || || ||||    
3'    uuccgucauccaacau  caa   uu ag acua   c
   ccc                gu   ---  g  g    ccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-let-7b-5p

Accession MIMAT0032701
Sequence

1 - 

ugagguaguagguugugugguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-let-7b-3p

Accession MIMAT0032702
Sequence

56 - 

cuguacaaccuacugccuuccc

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1