Stem-loop sequence ssa-let-7d-2

AccessionMI0026755 (change log)
DescriptionSalmo salar let-7d-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ssa-let-7d-2
(5 sentences)

Stem-loop
   --u   g   uu           ----    c  aau 
5'    gag uag  gguuguauggu    uucg au   a
      ||| |||  |||||||||||    |||| ||    
3'    uuc auc  ccaacauguca    aggc ug   a
   ccu   g   uu           auag    c  aca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-let-7d-5p

Accession MIMAT0032703
Sequence

1 - 

ugagguaguugguuguaugguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-let-7d-3p

Accession MIMAT0032704
Sequence

49 - 

cuguacaaccuucuagcuuucc

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1