Stem-loop sequence ssa-let-7e-1

AccessionMI0026756 (change log)
DescriptionSalmo salar let-7e-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ssa-let-7e-1
(5 sentences)

Stem-loop
   --u   gu         a         -----   uaua 
5'    gag  aguagauug auaguugug     ggg    u
      |||  ||||||||| |||||||||     |||     
3'    uuc  ucaucuaac uaucaauac     ccc    g
   ccu   ug         a         agucu   uccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-let-7e-5p

Accession MIMAT0032705
Sequence

1 - 

ugagguaguagauugaauaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-let-7e-3p

Accession MIMAT0032706
Sequence

52 - 

cuauacaaucuacugucuuucc

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1