Stem-loop sequence sja-mir-8185

AccessionMI0026815 (change log)
DescriptionSchistosoma japonicum miR-8185 stem-loop
Literature search

1 open access papers mention sja-mir-8185
(3 sentences)

Stem-loop
   c ga   g   c      -    gc    g    auaga    ag 
5'  g  uau cug ugcucc uuca  ugau ucuc     aucu  u
    |  ||| ||| |||||| ||||  |||| ||||     ||||   
3'  c  gua gau acgagg aagu  gcua ggag     ugga  g
   u ac   g   u      c    -a    -    ----g    cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15177v1; GCA_000151775.1) Overlapping transcripts
CABF01050135.1: 8914-8998 [-]
intergenic
Database links

Mature sequence sja-miR-8185

Accession MIMAT0032784
Sequence

55 - 

aggaucgaugaacggagcauu

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1