Stem-loop sequence ppc-mir-8255

AccessionMI0026916 (change log)
DescriptionPristionchus pacificus miR-8255 stem-loop
Stem-loop
   --      -   c    a  au      cgau 
5'   uaugcc ccg guca gg  caacuu    g
     |||||| ||| |||| ||  ||||||     
3'   auaugg ggu cagu cc  guugaa    a
   cg      a   -    a  cg      uagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000073.1: 237101-237162 [-]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-8255
ppc-mir-8300ABKE03000073.1: 238228-238291 [-]
ppc-mir-8352ABKE03000073.1: 237989-238049 [-]
ppc-mir-8255ABKE03000073.1: 237101-237162 [-]
ppc-mir-8356aABKE03000073.1: 236205-236266 [-]
ppc-mir-8356bABKE03000073.1: 236097-236161 [-]
ppc-mir-8307ABKE03000073.1: 235868-235928 [-]
ppc-mir-8274ABKE03000073.1: 234904-234962 [-]
ppc-mir-8320ABKE03000073.1: 227746-227804 [+]
ppc-mir-8358ABKE03000073.1: 227347-227413 [+]
ppc-mir-8282cABKE03000073.1: 227223-227281 [+]
Database links

Mature sequence ppc-miR-8255-5p

Accession MIMAT0032978
Sequence

1 - 

uaugccccgcgucaaggaucaacu

 - 24

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

Mature sequence ppc-miR-8255-3p

Accession MIMAT0032979
Sequence

39 - 

uuggcccaugacuggagguauagc

 - 62

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).