Stem-loop sequence ppc-mir-8263

AccessionMI0026933 (change log)
DescriptionPristionchus pacificus miR-8263 stem-loop
Stem-loop
   --        u  ga     c   -gcg  ug 
5'   cggucgaa cg  ucuca aga    cg  c
     |||||||| ||  ||||| |||    ||   
3'   gucagcuu gc  agggu ucu    gc  a
   ag        c  aa     c   guua  uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000073.1: 220213-220275 [+]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-8263
ppc-mir-2272ABKE03000073.1: 220023-220140 [+]
ppc-mir-8263ABKE03000073.1: 220213-220275 [+]
ppc-mir-2273ABKE03000073.1: 220330-220428 [+]
ppc-mir-8223ABKE03000073.1: 220630-220686 [+]
ppc-mir-2267ABKE03000073.1: 220769-220883 [+]
ppc-mir-8351ABKE03000073.1: 225677-225741 [+]
ppc-mir-8299ABKE03000073.1: 226063-226119 [+]
ppc-mir-8348ABKE03000073.1: 226430-226488 [+]
ppc-mir-8282bABKE03000073.1: 226545-226603 [+]
ppc-mir-8282aABKE03000073.1: 226753-226811 [+]
ppc-mir-8282cABKE03000073.1: 227223-227281 [+]
ppc-mir-8358ABKE03000073.1: 227347-227413 [+]
ppc-mir-8320ABKE03000073.1: 227746-227804 [+]
Database links

Mature sequence ppc-miR-8263-5p

Accession MIMAT0033010
Sequence

1 - 

cggucgaaucggaucucacaga

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppc-miR-8263-3p

Accession MIMAT0033011
Sequence

42 - 

ucugggaaacgcuucgacugga

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).