Stem-loop sequence ppc-mir-8307

AccessionMI0027000 (change log)
DescriptionPristionchus pacificus miR-8307 stem-loop
Stem-loop
   --     g        --c     ccaaa  ug 
5'   uauga acugccgu   cucaa     gu  c
     ||||| ||||||||   |||||     ||   
3'   auacu ugauggua   gaguu     cg  a
   cg     g        uuu     ---ug  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000073.1: 235868-235928 [-]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-8307
ppc-mir-8300ABKE03000073.1: 238228-238291 [-]
ppc-mir-8352ABKE03000073.1: 237989-238049 [-]
ppc-mir-8255ABKE03000073.1: 237101-237162 [-]
ppc-mir-8356aABKE03000073.1: 236205-236266 [-]
ppc-mir-8356bABKE03000073.1: 236097-236161 [-]
ppc-mir-8307ABKE03000073.1: 235868-235928 [-]
ppc-mir-8274ABKE03000073.1: 234904-234962 [-]
ppc-mir-8320ABKE03000073.1: 227746-227804 [+]
ppc-mir-8358ABKE03000073.1: 227347-227413 [+]
ppc-mir-8282cABKE03000073.1: 227223-227281 [+]
ppc-mir-8282aABKE03000073.1: 226753-226811 [+]
ppc-mir-8282bABKE03000073.1: 226545-226603 [+]
ppc-mir-8348ABKE03000073.1: 226430-226488 [+]
ppc-mir-8299ABKE03000073.1: 226063-226119 [+]
Database links

Mature sequence ppc-miR-8307-5p

Accession MIMAT0033140
Sequence

1 - 

uaugagacugccguccucaacc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppc-miR-8307-3p

Accession MIMAT0033141
Sequence

38 - 

uugaguuuaugguagugucauagc

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).