Stem-loop sequence ppc-mir-8352

AccessionMI0027060 (change log)
DescriptionPristionchus pacificus miR-8352 stem-loop
Stem-loop
   --     g    uug         -  gauc 
5'   ugugc ucga   auugccaac ug    g
     ||||| ||||   ||||||||| ||     
3'   auacg agcu   ugacgguug ac    u
   ug     g    cug         c  gaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000073.1: 237989-238049 [-]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-8352
ppc-mir-8300ABKE03000073.1: 238228-238291 [-]
ppc-mir-8352ABKE03000073.1: 237989-238049 [-]
ppc-mir-8255ABKE03000073.1: 237101-237162 [-]
ppc-mir-8356aABKE03000073.1: 236205-236266 [-]
ppc-mir-8356bABKE03000073.1: 236097-236161 [-]
ppc-mir-8307ABKE03000073.1: 235868-235928 [-]
ppc-mir-8274ABKE03000073.1: 234904-234962 [-]
Database links

Mature sequence ppc-miR-8352-5p

Accession MIMAT0033256
Sequence

1 - 

ugugcgucgauugauugccaacu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppc-miR-8352-3p

Accession MIMAT0033257
Sequence

39 - 

uuggcagugucucgaggcauagu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).