Stem-loop sequence ppc-mir-8356a

AccessionMI0027069 (change log)
DescriptionPristionchus pacificus miR-8356a stem-loop
Gene family MIPF0001997; mir-8356
Stem-loop
   --         c   -      u    ag au 
5'   aauuugaga ucg caugau gcau  u  g
     ||||||||| ||| |||||| ||||  |   
3'   uuaaacucu agu guacua ugua  a  a
   ac         u   u      -    ga gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000073.1: 236205-236266 [-]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-8356a
ppc-mir-8300ABKE03000073.1: 238228-238291 [-]
ppc-mir-8352ABKE03000073.1: 237989-238049 [-]
ppc-mir-8255ABKE03000073.1: 237101-237162 [-]
ppc-mir-8356aABKE03000073.1: 236205-236266 [-]
ppc-mir-8356bABKE03000073.1: 236097-236161 [-]
ppc-mir-8307ABKE03000073.1: 235868-235928 [-]
ppc-mir-8274ABKE03000073.1: 234904-234962 [-]
ppc-mir-8320ABKE03000073.1: 227746-227804 [+]
ppc-mir-8358ABKE03000073.1: 227347-227413 [+]
ppc-mir-8282cABKE03000073.1: 227223-227281 [+]
ppc-mir-8282aABKE03000073.1: 226753-226811 [+]
ppc-mir-8282bABKE03000073.1: 226545-226603 [+]
ppc-mir-8348ABKE03000073.1: 226430-226488 [+]
Database links

Mature sequence ppc-miR-8356a-5p

Accession MIMAT0033274
Sequence

1 - 

aauuugagacucgcaugauugca

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppc-miR-8356a-3p

Accession MIMAT0033275
Sequence

40 - 

uaucauguugauucucaaauuca

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).