Stem-loop sequence sma-mir-8437

AccessionMI0027230 (change log)
DescriptionSchistosoma mansoni miR-8437 stem-loop
Literature search

2 open access papers mention sma-mir-8437
(3 sentences)

Stem-loop
   uuuaa        u       -  g         a   c     aaacau 
5'      augauuuu acauuug gc cuuaguaga ugu accgu      u
        |||||||| ||||||| || ||||||||| ||| |||||      a
3'      uauugaga uguagac cg gaaucauuu aca uggca      u
   ----g        -       u  a         -   a     acauau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_3: 22962134-22962229 [+]
intergenic
Database links

Mature sequence sma-miR-8437-5p

Accession MIMAT0033578
Sequence

20 - 

uggcgcuuaguagaauguc

 - 38

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

Mature sequence sma-miR-8437-3p

Accession MIMAT0033579
Sequence

63 - 

uaacauuuacuaagagcucaga

 - 84

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).