Stem-loop sequence sma-mir-1a

AccessionMI0027256 (change log)
DescriptionSchistosoma mansoni miR-1a stem-loop
Gene family MIPF0000038; mir-1
Literature search

4 open access papers mention sma-mir-1a
(6 sentences)

Stem-loop
   ---gg                  ua     --uauau   a    gc  agua    cua 
5'      uaguaguaguaauaguag  gugau       gga ugug  ga    uggu   u
        ||||||||||||||||||  |||||       ||| ||||  ||    ||||    
3'      auuauuauuauuaucauu  uauua       ucu guac  cu    auca   g
   augua                  uc     ugauaau   a    ua  -aag    uug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_W: 827970-828085 [-]
intergenic
Database links

Mature sequence sma-miR-1a-5p

Accession MIMAT0033630
Sequence

32 - 

uggaauguggcgaaguaugg

 - 51

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).