Stem-loop sequence sma-mir-2162

AccessionMI0027274 (change log)
DescriptionSchistosoma mansoni miR-2162 stem-loop
Gene family MIPF0001950; mir-2162
Literature search

2 open access papers mention sma-mir-2162
(4 sentences)

Stem-loop
   aggac    --cua ag    c u     -    cc     a    au     gg   g       u     a  c 
5'      caug     a  augu g uugga ugga  ucucu gggg  gagug  aug uugcaua auaca ug u
        ||||     |  |||| | ||||| ||||  ||||| ||||  |||||  ||| ||||||| ||||| ||  
3'      guac     u  uaca c aacuu aucu  aggga cccc  cucac  ugc aacguau uaugu ac g
   auuaa    uuucg ga    u c     c    -c     -    au     uu   -       -     a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
SC_0049: 36149-36295 [+]
intergenic
Database links

Mature sequence sma-miR-2162-5p

Accession MIMAT0033665
Sequence

47 - 

agugggaugguugcauauauac

 - 68

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

Mature sequence sma-miR-2162-3p

Accession MIMAT0033666
Sequence

82 - 

uauuaugcaacguuucacucu

 - 102

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).