Stem-loop sequence sma-mir-2f

AccessionMI0027287 (change log)
DescriptionSchistosoma mansoni miR-2f stem-loop
Literature search

4 open access papers mention sma-mir-2f
(10 sentences)

Stem-loop
      ua  u     ug  uc      a   ug      g  aau 
5' cga  cc ggugu  au  uggcug gau  aggcag aa   a
   |||  || |||||  ||  |||||| |||  |||||| ||   a
3' guu  gg ccaua  ua  accgac cug  uccguu uu   a
      gc  c     gu  ua      a   --      g  aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_5: 1982640-1982726 [-]
intergenic
Clustered miRNAs
< 10kb from sma-mir-2f
sma-mir-71bChr_5: 1982759-1982850 [-]
sma-mir-2fChr_5: 1982640-1982726 [-]
sma-mir-2dChr_5: 1982526-1982613 [-]
sma-mir-2cChr_5: 1982423-1982497 [-]
Database links

Mature sequence sma-miR-2f-3p

Accession MIMAT0033691
Sequence

60 - 

ucacagccaauauugauaccc

 - 80

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).