Stem-loop sequence pxy-mir-8486

AccessionMI0027289 (change log)
DescriptionPlutella xylostella miR-8486 stem-loop
Stem-loop
   aaa     u  c   c                          a    uuaauuuu       c  gu 
5'    aacag cu agc agguauacuguuggaguuaucauuaa agau        guuuugu cu  a
      ||||| || ||| |||||||||||||||||||||||||| ||||        ||||||| ||   
3'    uuguc ga uug uccauauggcaacuucaauaguaauu uuug        cagaaua ga  c
   gcc     u  u   c                          a    --------       a  aa 
Get sequence
Deep sequencing
31 reads, 775 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_615: 90836-90963 [+]
intergenic
Database links

Mature sequence pxy-miR-8486

Accession MIMAT0033693
Sequence

88 - 

uaaugauaacuucaacggua

 - 107

Get sequence
Deep sequencing6 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1