Stem-loop sequence pxy-mir-8487

AccessionMI0027290 (change log)
DescriptionPlutella xylostella miR-8487 stem-loop
Stem-loop
   -aaa           -   -       auaaaaaugauaaugaccua 
5'     auaucuccuug ugu ucaauca                    g
       ||||||||||| ||| |||||||                    g
3'     uauagagggau aua aguuggu                    u
   ucgg           g   u       agacaaacacgaccccaaac 
Get sequence
Deep sequencing
79 reads, 2.4e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_199: 1106317-1106410 [-]
intergenic
Database links

Mature sequence pxy-miR-8487

Accession MIMAT0033694
Sequence

75 - 

uauaguagggagauaugg

 - 92

Get sequence
Deep sequencing79 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1