Stem-loop sequence pxy-mir-8488

AccessionMI0027291 (change log)
DescriptionPlutella xylostella miR-8488 stem-loop
Literature search

1 open access papers mention pxy-mir-8488
(1 sentences)

Stem-loop
   -----aaaaugu   u      u    -  c               a    aguuu 
5'             uag cuaugg caac ag ugucaguuucuuagu gaua     a
               ||| |||||| |||| || ||||||||||||||| ||||      
3'             auc gguauc guug uc auagucaaaggguca cuau     u
   uacuacaucaau   u      u    g  -               -    cuuaa 
Get sequence
Deep sequencing
19 reads, 525 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_83: 422117-422222 [-]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-8488
pxy-mir-2733ascaffold_83: 426291-426376 [-]
pxy-mir-8488scaffold_83: 422117-422222 [-]
Database links

Mature sequence pxy-miR-8488

Accession MIMAT0033695
Sequence

23 - 

agcugucaguuucuuaguagaua

 - 45

Get sequence
Deep sequencing8 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1