Stem-loop sequence pxy-mir-8489a

AccessionMI0027292 (change log)
DescriptionPlutella xylostella miR-8489a stem-loop
Gene family MIPF0002034; mir-8489
Stem-loop
   aaa     -   u     -               c   u   ucca 
5'    uggcc aau uagug gccguuaccucugag uug aug    u
      ||||| ||| ||||| ||||||||||||||| ||| |||     
3'    aucgg uua aucac cggcaauggagacuu aac uac    a
   guc     a   c     a               a   c   uuaa 
Get sequence
Deep sequencing
234 reads, 5.95e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_70: 783516-783607 [+]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-8489a
pxy-mir-8489ascaffold_70: 783516-783607 [+]
pxy-mir-8489bscaffold_70: 783518-783605 [-]
Database links

Mature sequence pxy-miR-8489a-5p

Accession MIMAT0033696
Sequence

18 - 

gccguuaccucugagcuugua

 - 38

Get sequence
Deep sequencing6 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence pxy-miR-8489a-3p

Accession MIMAT0033697
Sequence

55 - 

caaauucagagguaacggcaca

 - 76

Get sequence
Deep sequencing228 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1