![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence pxy-mir-8490 |
|||||
Accession | MI0027293 (change log) | ||||
Description | Plutella xylostella miR-8490 stem-loop | ||||
Stem-loop |
aac uu u ga 5' cc acaga agacagacaccgucaaacaaagu u || ||||| ||||||||||||||||||||||| c 3' gg ugucu ucugucuguggcaguuuguuuca c guc uc c au |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence pxy-miR-8490 |
|
Accession | MIMAT0033698 |
Sequence |
47 - uuguuugacggugucugucucu - 68 |
Deep sequencing | 3 reads, 3 experiments |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:24236051
"Identification and developmental profiling of microRNAs in diamondback moth, Plutellaxylostella (L.)"
PLoS One. 8:e78787(2013).
|