Stem-loop sequence pxy-mir-8490

AccessionMI0027293 (change log)
DescriptionPlutella xylostella miR-8490 stem-loop
Stem-loop
   aac  uu     u                       ga 
5'    cc  acaga agacagacaccgucaaacaaagu  u
      ||  ||||| |||||||||||||||||||||||  c
3'    gg  ugucu ucugucuguggcaguuuguuuca  c
   guc  uc     c                       au 
Get sequence
Deep sequencing
13 reads, 325 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_153: 325167-325245 [+]
intergenic
Database links

Mature sequence pxy-miR-8490

Accession MIMAT0033698
Sequence

47 - 

uuguuugacggugucugucucu

 - 68

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1