Stem-loop sequence pxy-mir-8491

AccessionMI0027294 (change log)
DescriptionPlutella xylostella miR-8491 stem-loop
Literature search

1 open access papers mention pxy-mir-8491
(2 sentences)

Stem-loop
   aag  a     uaua    gu   u       -     a      c          ac  g 
5'    ac agagu    gcua  ugg agcuucu ggagu gauagu agguaaacga  gu c
      || |||||    ||||  ||| ||||||| ||||| |||||| ||||||||||  ||  
3'    ug ucucg    ugau  acu ucggaga ccuca cuauua uccguuugcu  cg c
   uaa  g     ---c    --   -       u     a      u          -c  a 
Get sequence
Deep sequencing
54 reads, 1.42e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_380: 6960-7075 [+]
intergenic
Database links

Mature sequence pxy-miR-8491

Accession MIMAT0033699
Sequence

35 - 

aguagauagucagguaaacga

 - 55

Get sequence
Deep sequencing54 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1