Stem-loop sequence pxy-mir-8492

AccessionMI0027295 (change log)
DescriptionPlutella xylostella miR-8492 stem-loop
Stem-loop
   aag   g     aa            uu   a  a  c    ag 
5'    gug uggaa  acuggauacccu  cgu ug uu ucag  g
      ||| |||||  ||||||||||||  ||| || || ||||   
3'    cac acuuu  ugaccugugggg  gca ac aa aguc  a
   aga   g     aa            gc   c  a  c    aa 
Get sequence
Deep sequencing
18 reads, 450 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_179: 94090-94179 [-]
intergenic
Database links

Mature sequence pxy-miR-8492

Accession MIMAT0033700
Sequence

55 - 

aacacacgcggggguguccagu

 - 76

Get sequence
Deep sequencing14 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1