Stem-loop sequence pxy-mir-8493

AccessionMI0027296 (change log)
DescriptionPlutella xylostella miR-8493 stem-loop
Stem-loop
   aau  u   uu         c     a   a   aau 
5'    ag ucu  agugaugcu cugaa uuc uag   u
      || |||  ||||||||| ||||| ||| |||    
3'    uc aga  ucacuacga gacuu aag auc   u
   uac  u   uc         c     a   c   aac 
Get sequence
Deep sequencing
22 reads, 600 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_127: 944000-944075 [+]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-8493
pxy-mir-8521b-10scaffold_127: 934840-934904 [+]
pxy-mir-8521b-1scaffold_127: 936871-936942 [+]
pxy-mir-8543scaffold_127: 938549-938622 [+]
pxy-mir-8493scaffold_127: 944000-944075 [+]
Database links

Mature sequence pxy-miR-8493

Accession MIMAT0033701
Sequence

44 - 

uacgaaauucagcagcaucacu

 - 65

Get sequence
Deep sequencing22 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1