Stem-loop sequence pxy-mir-8493

Accession

MI0027296 (change log)

Description

Plutella xylostella miR-8493 stem-loop

Stem-loop

   aau  u   uu         c     a   a   aau 
5'    ag ucu  agugaugcu cugaa uuc uag   u
      || |||  ||||||||| ||||| ||| |||    
3'    uc aga  ucacuacga gacuu aag auc   u
   uac  u   uc         c     a   c   aac 

Deep sequencing

22 reads, 600 reads per million, 4 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (1.0): scaffold_127: 944000-944075 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from pxy-mir-8493

• pxy-mir-8521b-10: scaffold_127: 934840-934904 [+]
• pxy-mir-8521b-1: scaffold_127: 936871-936942 [+]
• pxy-mir-8543: scaffold_127: 938549-938622 [+]
• pxy-mir-8493: scaffold_127: 944000-944075 [+]

Database links

• miRBase Tracker:MI0027296

Mature sequence pxy-miR-8493

• Accession: MIMAT0033701
• Sequence: 44 - uacgaaauucagcagcaucacu - 65
• Deep sequencing: 22 reads, 4 experiments
• Evidence: experimental; Illumina [1]

References

1. PMID:24236051 "Identification and developmental profiling of microRNAs in diamondback moth, Plutellaxylostella (L.)" Liang P, Feng B, Zhou X, Gao X PLoS One. 8:e78787(2013).