Stem-loop sequence pxy-mir-8495

AccessionMI0027298 (change log)
DescriptionPlutella xylostella miR-8495 stem-loop
Stem-loop
   aau  aagaa          g   a                  a  u  ug 
5'    gg     ugcuguggug agc gagucuugacauguucca cg gu  u
      ||     |||||||||| ||| |||||||||||||||||| || ||  c
3'    cc     gcggcacuac ucg cucagaacuguacggggu gc cg  g
   gcu  -ggua          g   g                  c  -  ug 
Get sequence
Deep sequencing
191 reads, 4.98e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_161: 120559-120661 [-]
intergenic
Database links

Mature sequence pxy-miR-8495-5p

Accession MIMAT0033704
Sequence

25 - 

agagucuugacauguuccaacg

 - 46

Get sequence
Deep sequencing99 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence pxy-miR-8495-3p

Accession MIMAT0033705
Sequence

61 - 

cuggggcaugucaagacucggc

 - 82

Get sequence
Deep sequencing81 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1