Stem-loop sequence pxy-mir-8499b

AccessionMI0027303 (change log)
DescriptionPlutella xylostella miR-8499b stem-loop
Gene family MIPF0002029; mir-8499
Stem-loop
   acu      u   -           u         uaa 
5'    gcgagg aaa caucgaccaau aaauugcau   a
      |||||| ||| ||||||||||| |||||||||   c
3'    cgcucc uuu guagcugguua uuuaacgua   g
   acu      -   a           c         cuc 
Get sequence
Deep sequencing
60 reads, 1.55e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_12: 1642410-1642486 [+]
intergenic
Database links

Mature sequence pxy-miR-8499b

Accession MIMAT0033710
Sequence

47 - 

caauuucauuggucgaugauu

 - 67

Get sequence
Deep sequencing26 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1