Stem-loop sequence pxy-mir-8501

AccessionMI0027305 (change log)
DescriptionPlutella xylostella miR-8501 stem-loop
Stem-loop
   aga            g                       u 
5'    accgacgcgaau acaacuucagaugcacucaagau a
      |||||||||||| |||||||||||||||||||||||  
3'    uggcugcgcuua uguugaagucuacgugaguucua c
   caa            a                       u 
Get sequence
Deep sequencing
13 reads, 325 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_231: 481883-481964 [+]
intergenic
Database links

Mature sequence pxy-miR-8501

Accession MIMAT0033712
Sequence

47 - 

uugagugcaucugaaguuguaa

 - 68

Get sequence
Deep sequencing9 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1