Stem-loop sequence pxy-mir-252

AccessionMI0027306 (change log)
DescriptionPlutella xylostella miR-252 stem-loop
Gene family MIPF0000285; mir-252
Stem-loop
   aga       -   g  cc        agu  c       --u  u 
5'    acuaaau cuu uu  uaaguacu   gc gcaggag   gu u
      ||||||| ||| ||  ||||||||   || |||||||   ||  
3'    ugauuua gaa aa  auucguga   cg cguccuc   ca u
   ucg       u   g  cu        auu  u       uau  u 
Get sequence
Deep sequencing
106 reads, 2.72e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_387: 153584-153674 [-]
intergenic
Database links

Mature sequence pxy-miR-252

Accession MIMAT0033713
Sequence

18 - 

cuaaguacuagugccgcaggag

 - 39

Get sequence
Deep sequencing101 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1