Stem-loop sequence pxy-mir-8502

AccessionMI0027307 (change log)
DescriptionPlutella xylostella miR-8502 stem-loop
Stem-loop
   aga     --------u      --     a u                    u   uaau 
5'    caacc         uugcaa  gguuu g cgcugaaugccgacauucug aag    a
      |||||         ||||||  ||||| | |||||||||||||||||||| |||     
3'    guugg         aacguu  ccgaa c gcgacuuacggcuguaggac uuu    g
   aag     cgcauccau      uc     g u                    c   uaau 
Get sequence
Deep sequencing
67 reads, 1.88e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_390: 456777-456890 [+]
intergenic
Database links

Mature sequence pxy-miR-8502

Accession MIMAT0033714
Sequence

62 - 

caggaugucggcauucagcg

 - 81

Get sequence
Deep sequencing61 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1